Secret Militant Feminist Agenda

[ElephantsAndMiasmas]

...what is it then? I keep reading about it as a reason for us all Lying Our Terrible Lies about being harrassed in the street, or beaten up at home or what have you.

It's making me feel a bit left out TBH.

Can someone drop me a hint about why we're talking about these things, given that they cannot be true in the egalitarian paradise in which we live?

Code is permitted.

No, no sorry - didn't really mean it like that. Bad timing - it wasn't intended for wukter or Elephants. I posted before I saw your posts - just read them now.

I more meant that we seem to be back in the groundhog the other thread turned into. (Before it got really messy).

We are making jokes about windscreen wipers on the other thread now anyway.

I do wonder if some posters just come in with a ready made spiel and just plonk it onto any thread they happen to come across.:)

It's almost admirable. I have no idea how we got my beribboned feminist beasts of burden to army discipline.

Anyway...

Instead of the traditional seasonal gift of a rape alarm, new for 2010 <a class="break-all" href="http://www.google.co.uk/imgres?imgurl=www.farmerswarehouse.com.au/images/T/Bloodless%2520(Burdizzo-type).bmp&imgrefurl=www.farmerswarehouse.com.au/home.php%3Fcat%3D536&usg=__egqdIABdIrJRO0ZpR96Hzl_Sjq8=&h=126&w=334&sz=124&hl=en&start=0&zoom=1&tbnid=GAZY2-1HNbmZIM:&tbnh=69&tbnw=183&prev=/images%3Fq%3Dcastrators%2Bbloodless%26um%3D1%26hl%3Den%26sa%3DN%26rlz%3D1T4ACPW_en___GB365%26biw%3D1076%26bih%3D426%26tbs%3Disch:1&um=1&itbs=1&iact=hc&vpx=466&vpy=124&dur=3548&hovh=100&hovw=267&tx=131&ty=78&ei=tCajTJPbF4724Abqm8CRBA&oei=tCajTJPbF4724Abqm8CRBA&esq=1&page=1&ndsp=10&ved=1t:429,r:2,s:0" rel="nofollow" target="_blank">these, in Holly Red or Ivy Green.

chin up, SF.

For the more agriculturally minded, how about trading in your old cocklodger for a <a class="break-all" href="http://www.google.co.uk/imgres?imgurl=www.websters-online-dictionary.org/images/wiki/wikipedia/en/thumb/2/26/DSCN6567.JPG/300px-DSCN6567.JPG&imgrefurl=www.websters-online-dictionary.org/dictionary.asp%3Fdictionary%3Dnon-english%26reference%3Denglish%26education%3Drooster%26information%3DSpanish&usg=__0fn4ELZ7tRWks7SB-dOP2_V1wT8=&h=225&w=300&sz=16&hl=en&start=0&zoom=1&tbnid=WgesFU5npO0dmM:&tbnh=147&tbnw=185&prev=/images%3Fq%3Dcocklodger%26um%3D1%26hl%3Den%26sa%3DN%26rlz%3D1T4ACPW_en___GB365%26biw%3D1076%26bih%3D426%26tbs%3Disch:10%2C51&um=1&itbs=1&iact=hc&vpx=810&vpy=167&dur=101&hovh=180&hovw=240&tx=114&ty=127&ei=Bi6jTOvyLJSOjAfUxZmrAw&oei=8y2jTO-PNYex4AbIj7mVBA&esq=6&page=1&ndsp=9&ved=1t:429,r:8,s:0&biw=1076&bih=426" rel="nofollow" target="_blank">nice new one?

What is our aim though, do we want to kill all men, steal their willies or merely force other women to plait their armpit hair?

Ooh how about a nice plaited-armpit-hair fruit basket?

okay so long as fruit is womb shaped and not phallic!

mangoes only, witchy. Possible passionfruit? Or too many seeds? :o

passionfruit and kiwi fruit certainly as their penetration with a spoon that removes their essense is deeply symbolic of our oppression in the past!

oooh yeeeah! Certainly we will be bulk ordering from here

[looks furtively 'round] Is it all clear now?

Well where were you all?? I was waiting in underground lair 2 but no-one turned up.

Still I've worked out some great plans I think. Should have this one sown up in no time.

I've done a bit of research and found this.
I'm thinking we've obviously got the resources needed here, that's been proved beyond doubt, so maybe we could run with it. Just a word in the right direction I think.

[walks cheerfully in]

HEY IVE GOT A GOOD IDEA.

Careful they'll hear us!

What's your idea? Do we need to talk in code?

YES
we need a code.

ok- .... ........... .......

does this sound good?

- @@ // %$£ - ***,?&^""{;}

What about Morse code? Anyone know it?

Alice - loved the article blueprint. Who could we get in to do it though? It needs someone with real cojones.

Anyone else feel like patriarchy-smashing is in their genes?

CCACTTGTCGTTGATGGAGACATGGTTGAGCTTATGGCGCGTGGGGAGGGCTAAGGACTGATGGATGTCATGGGCTAAGTTATGGGCGAAATGGTTGAGCTTATGGAGTAAGTTCTCGAG

Morse code is a patriarchal construct.

What does this remind you of eh?

.

.

You see?

And Morse was a bit of a tosser who drank too much and liked Wagner.

DNA on the other hand, has Saint Rosalind

Okay - Wagner - ummm, that's a no then!

CATGGCATGTAGGAGCGTGTTATGCTGCGTTCAATGGAAGGCGTAATGGTTGAGCTTATGGTACTTTACGGCGCGTAAGTTGATGGCGGAATGGTTGAGCTTGGA

(not v good at this secret thing)

Never heard of St Rosalind before - every day I learn something new here.

I like that she is 'Sylvia Plath of molecular biology'. I hope there is a SP of all very specific types of science.

Oh hello I'm late to this...

I haven't had my membership pack either

But I have got some tinfoil I can fashion into popsocks if that's any good?