To think autism gets worse with each generation

[eastereggg]

Genuine question.

Why does it seem that autism gets worse with each generation?

Example: a mother is a late diagnosed autistic but her child is very clearly autistic and displays much more severe characteristics than she did. The grandmother would probably be diagnosed autistic today as well.

There seems to be a recurring pattern that I'm seeing where autism is getting more severe with each generation. Is there an explanation for this?

Please, don't spread misinformation. Autism is genetic. There is a link between men over the age of forty who father children and autism, but nothing is proven.

Autism is also on a spectrum. I have seen lots of families where the father actually has it worse than his children, but his children are still affected.

We also live in an ever more complex world with more and more people living in close proximity to each other. This means that even mild autism can be a huge stumbling block for day to day life. There are simply more triggers and the demands on our brains are a lot higher than, say, 50 years ago. People with mild autism used to be considered "a little odd", but if you could speak and were reasonably intelligent, experts wouldn't even consider autism as a diagnosis.

It's not so much the increase in diagnoses I was thinking about but more the increase in severity. There seems to be at least one child in each class and I'm not sure it was this bad years ago. I could be completely wrong but I'm diagnosed and interested in other people's knowledge and experiences.

Late diagnosed autistic mothers who have high needs ever dependent autistic children do not have that much in common with their offspring. The diagnostic criteria is now so broad they both carry the descriptor “autism” but they are not experiencing the same deficits or challenges. You might just as well be saying why are so many pale skinned redheads having more albino children. Are they, and is there any connection at all?

The world is a much more difficult place to live in than it was 30/40/50 years ago. I believe this is one of the reasons why there seem to be growing numbers of SN in schools. Children can’t cope with the pressure to perform, the rigid attendance targets, the need to fit in with poor quality and prescriptive support. The increased tech in the classroom, the need to fill every inch with shiny laminated useful information, the more sociable way of being schooled, more group work.

The NHS is on its knees in so many ways, autism diagnosis is one of them. It’s outdated and the waiting lists are so long, and during assessments it’s well known that many teachers are obstructive and lie about the children they are being asked about. What a waste of everyone’s time!

There will be other reasons, like tech use (iPad babies is a growing term for more young children appearing to have traits of autism due to neglect and too much reliance on screens).
Covid has had a big impact socially on children.

We also can’t ignore growing evidence of gut biome information, which is usually dismissed where autism is concerned, can’t fathom why, because it is intriguing. Anecdotally i know that eating a low carb diet improves my sensory difficulties and clears brain ‘noise’, and many I’ve spoken to say the same.
I saw microplastics were mentioned earlier, it’s a mistake to ignore this and other relatively new toxins - I mean, we don’t have a clue how any of these may play a detrimental role in human development at any age. Nothing should be discounted, it should all be investigated. Not in order to play at eugenics, but if something’s causing a rise in disability we surely need to understand what’s going on.

Yes it is increasing but not with each generation (the increase is not genetic) but year upon year. This means the causes are predominantly environmental--ie due to exposures. See the yearly increase figures cited by Dr John Campbell in this:
s

In general, a condition that worsens with successive generations is because the data error gets larger with each subsequent passing on

So Mom has a gene that has CGCGTTTTAAAACGCG with the TA being the error. When it's passed on the child's gene reads CGCGTTTTTAAAAAAAATTTTTCGCG. The grandparent may have had CGCGTACGCG and a grandchild CGCGTTTAAATATATATATATTTTAAATACGCG
and at that point it's so significant that they are unlikely to have children of their own / die before they can. I think Huntingtons is like that? So there could be that effect in some cases of autism but I'm not sure there's a clear idea of causes

So are you saying you don't think the spectrum is valid then

Agree- The financial benefits can be large, especially with a car.
Even more so if the parents make a you tube channel out of their children. ( It shouldn’t be allowed as the children can’t consent)

It's actually most likely a very complex combination of genetic and environmental factors.

I find it fascinating listening to family tales through a ND lens. The great uncle who kept himself to himself, spent hours in a shed and liked trains; my grandmother who was a bit odd, set in her ways and was a bit of a battle axe who rubbed people up the wrong way etc. So many times now I think that surely they're describing someone with autism.
What I also think, looking back to the people of my grandmothers generation, was that there were so many "surplus" women whose husbands/fiancés or those they would have gone on to marry had died in the war. These women often had idiosyncrasies which were put down to them being spinsters. Perhaps, actually, being a spinster meant that they felt less need to mask and fit in.
Going back a few generations, a lot of things were routine and mundane whether that was making bread, beating the carpets, digging the vegetable patch. That sort of repetitive behaviour can be quite soothing, especially if done in a peaceful environment (which it would have been as there wouldn't have been a podcast to catch up on or the radio to listen to). Also, people naturally walked much more as that was the main mode of transport. Think how much that is recommended these days for mental health.

My DD1 has an ASD diagnosis & I am awaiting an assessment for DS2 who appears to be ND and presents with very different ASD traits. I suspected very early on that DD1 was ND - she taught herself to read before she was 2 but that was ignored as a stealth brag by health visitor & doctor 🙄 Her father - exH - was never diagnosed but I asked him to take an assessment which he did & even though he didn’t receive an official diagnosis he felt certain that he was ND & so was his Mother.

I don’t know if it’s getting worse … I do think we have a better knowledge and more access to information these days.

The diagnosis has helped my DD1 immensely!

No if I didn’t say that at all. I’m not sure what you understand by “spectrum” or why you think it is or isn’t valid but it’s a useful model and can help people understand how there are so many presentations of autism.

If you think about it though, with each generation, each historical period of time gets more socially overwhelming as well.

So someone who is autistic in the 1950’s had less environmental and social stimuli to cope with than say the next generations in the 70’s and 90’s.

In the 1950’s Tv was only just invented and so children played outside in nature much more. They barely had any toys - just a few special ones.
They had to use their imagination a lot more than today.
School was basic, simple and with lots of playing time and not much homework.

Shopping centres, modern cinemas with surround sound, motorways with tons of traffic, pop music with loud electronic sound ……didn’t exist.

Everything in those days could probably have been a lot more manageable than for an autistic child today. The amount of stimuli our autistic children have to cope with today is just huge.

Put my DS in a class of 30 loud children and he’d have a meltdown when he got home.
Put him in a fast flowing stream with bare feet in Scotland or sitting in a mud hole making mud bombs …..happy as Larry all day long.

Not autism, but in families with hereditary breast cancer, there's a tendency for each successive generation to be diagnosed earlier, if it happens.

Seems like there COULD be some common mechanism that creates this pattern in more diseases than just autism.

It’s not a disease.

You know iits,a massive spectrum right ?
Most children with autism wouldn't qualify for HRM, and those that do will have significant and complex,needs and likely to need looking after for the rest of their life .

Anecdotally, for my family it's the opposite. No diagnoses in anyone but my maternal grandfather was almost certainly autistic. He was seen as very intelligent, very eccentric and somewhat abusive as he would force his way of thinking and could not consider anyone else's point of view.
My mum was intelligent but very rigid in her thought processes and no filter during conversation. I struggled a lot with my relationship with her as I thought she hated me due to some of the things she'd come out with. It's only in the last couple of years that I've thought she might well have been autistic too.
My DB is very talented in his niche field and has quite specific interests and has an unusual way in conversation (sorry hard to describe - he's not rude in any way). I have a few sensory issues and like a routine but nothing that would be worth diagnosing or has held me back in any way.
Nothing glaring in my DCs. DD can be stubborn but that could well just be her.
So, for us it's filtered down instead. That's if there was any autism to start with. It's all based on my (strong) suspicions.

I can assure you it is NOT financially lucrative to have a disabled child. It’s really really expensive and those that do it on benefits without any other funding must be scraping by on every level.

I don’t know how to phrase but for example older People in our family who had not as obvious to the public autism had to just get on with it whereas now it’s seen, diagnosed and people are given more leniencies to allow them to function and exist in todays world and so it’s more obvious

"In the 1950’s Tv was only just invented and so children played outside in nature much more. They barely had any toys - just a few special ones.
They had to use their imagination a lot more than today.
School was basic, simple and with lots of playing time and not much homework."

I'd add that 'playing out' and having to walk everywhere was physically exhausting, and if you wanted food or drink, it was low in sugar and had no caffeine or other junk additives to hype you up.

I'd be extremely wary of Campbell. He is a well-known provider of COVID-19 misinformation, and the comments in the video about Donald Trump and RFK Jr. do rather suggest that this video is in the same vein.

Couldn't agree more. How many parents out of thousands are really making a tonne out of their kids via YouTube; seriously.

Spot the people who do not have SEN kids.

Are you comparing like with like though? Adults with autism will have developed some work arounds, built skills etc.

@Ineffable23 casual link? Or maybe you mean causal….

It has many factors including environmental, many years ago I worked for a very intelligent pharmacist and he said cooking materials were a lot to do with different conditions, we are constantly ingesting different metals and plastics that we should not be and did not years ago, I would imagine these do play a large part in increasing numbers of different conditions, we also ingest large amounts of pollution on a daily basis, something that would not have happened years ago, all these things contribute to the body’s cells malfunctioning……