to wonder if this product of mine is too niche for mass appeal?

[Timeforanamechangy]

I'm not sure if that's the right word I'm searching for here but I'm sure a helpful MNetter with correct me if not!

I make jewellery and I have a product which I personally really like but I don't know if its something that will appeal to a wide market and if I should bother trying to sell it or if its something that only appeals to me and others that work in a particular area.

Obviously I realise that I can't really expect you to comment without knowing what it is, and this may out me but here it is:

Its a 'DNA' bracelet. Well, it looks like a strand of DNA, using pairs of different coloured beads to simulate the A-T/G-C base pairs and either leather or hemp cord. I vary the patterns of the beads each time I make one to try and make each bracelet unique

Aibu to think this is this something people will be interested in? Or is it a bit too geeky to have mass appeal?

I like the twisty-ness of the DNA bracelet. I think it'd work well in lighter colours for Summer too. It's not my personally style but I can see why lots of people would like them. Folksy was a good suggestion up thread. Go for it, sounded like there wasn't much to lose.

They do not look like something a child would make as a pp said. It is obvious the OP has skill and they aren't something anyone could make. Honestly have you seen the shit people try to sell on Facebook? These are in another league and are actually nice, well made pieces.

As a DNA scientist I would say that DNA scientists are absolutely not the market for your bracelet for many reasons, not least that we can't wear jewellery in the lab. Also DNA is not a novelty for us. It would be like buying a charm bracelet with transport charms for a train driver.

But I think there is a USP. You can spell out names in DNA, if you translate them into the protein. Not all letters are included so it is limited. But it would be a way to personalise them.

The bracelets are very pretty :)

The problem is that if you are planning to sell them online then you really do need great photos that show them off. I have a friend who sells jewellery online and her stuff is really beautiful, it looks like she spent a lot of time making it and great photos. She's obviously very talented. There's a ton of jewellery sellers out there, so you have to be able to really stand out from the crowd, and even then most people don't make a huge amount of money from it. If you are passionate about jewellery-making then perhaps set up an online shop as a hobby and see how it goes? It can take years and years to build up a client base. If you just had an idea and thought it would be an easy way to make money, then I think you'll struggle.

I am a geneticist by training and was going to suggest exactly the same idea as grumpy!

This is a link to all the "letters" available according to combinations of A, T, C and G in groups of 3. Each triplet produces a separate amino acid with a letter as a symbol. Not all letters covered, but easy to use other letters to compensate. That would be a VERY cool idea!

I also agree making the bracelet more "obviously" DNA, as other posters have suggested, would make it more appealing.

And actually, as a scientist myself, I am going to disagree with grumpy in that I would LOVE ton wear one of those bracelets with my name coded in it!!!

I like it! I'm glad you posted a pic.

It is a lot prettier when you zoom in on it.

Depending on where you bars horse hair bracelets can be hard to sell. The market is flooded with people on making.

*flooded with people making them

I think you should make the beads more colourful, more like a scientific model.

And you should stop displaying them on the back of a Labrador.

I don't have a labrador tiggy, its just a fluffy blanket

I think I do need to make a stronger contrast between the different coloured beads as it isn't immedately obvious that there are 4 different ones, I just don't want it to look too garish?

Thanks coconutty

I have a double helix necklace, A-T earrings and a whole bunch of molecular structure necklaces so I think I'm definitely the person your trying to appeal to. I would say I don't think that looks obviously DNA. I need stuff like that at conferences to pull people into talk to me. I don't think that is obvious enough to do what I need it to.
They are very pretty though. Maybe work out what you want to charge and stick a few on eBay/Facebook/etsy and test the market

Aurynne I love that idea with the coded names, thank you for the link!

For the letters that don't have a code, can you just assign a letter to one of the codes that has a multiple of a letter? Eg, if there is no 'U' you could assign the 'U' to a triplet that has an 'L' letter as there are multiple L's? Or is that too much like just making it up and too far from reality? not clever enough

Timeforanamechangy, if you want to appeal to the geeky market you would not get away with changing the rules of the genetic code ;)

The way it works is this: imagine you want to code my nickname, "aurynne". in order to code letter A you could use any of the combinations that produce the amino acid "alanine": GCT, GCC, GCA or GCG. There is no "U", but it would be easy to use the "V" instead, for which you could use any of the combinations which would produce Valine (Val or V). The choice of triplet could depend on the colours you have chosen for each of the initial bases (A, C, G, T) and which one would look better. For example, this combination:

GCTGTAAGGTATAATAACGAG

Spells "AVRYNNE" (the closest you could get to my nickname using amino acid letters :)

Let me know if this is clear.

Letters missing from the code: B, J, O, U, X, Z

Suggestions:

O could be replaced by Q
U could be replaced by V
There are not many names containing X or Z, depending on the name I am sure you could compromise in a combination of letters?
The B is the hardest to replace, perhaps P, depending on where in the word it is?

Ok yeah that makes sense :)

The coding bracelet idea is done at the Cambridge Science Festival, but less sophisticated than these bracelets as they use little plastic cubes.
It's very popular though :)

It just looks like an ordinary necklace to me and would not appeal. I'm not a sciencey person though - more interested in jewellery looking beautiful, not being meaningful.

I have a horsehair bracelet made from my horse that died on the gallops with me.

I would go that route - I was doing well getting it for £70. A friend of mine paid £150. A lot of my friends have bought them to remember their sold/deceased horse/pony.

The bead bracelets are a nothing special and I wouldn't pay more than a fiver/tenner for them.

I think some people on here are incredibly rude

People aren't being rude, the OP wanted honest opinions.

I think it looks like it should only cost a few pounds. It's sweet but doesn't look like DNA.

I also don't like the horse hair bracelets but as I'm not a horse owner i doubt I'm the target audience,